Genetics
Bradley E. Aouizerat
Nearly 6 decades ago, Watson and colleagues discovered the secret of life when they published the chemical structure of DNA.1 The double helical structure made immediately obvious how this molecular archive of life could encode information in the copious quantities necessary to program a living cell. This discovery set into motion a revolution that has continued to unfold to this day, much of it guided by this original discovery.
Research is a slow process, often with years between each sensation, and even today, the DNA revolution remains largely behind laboratory doors, in the form of scientists’ ever-increasing understanding of the mechanisms of life. But a few powerful inventions —forensic DNA examination, DNA-based drug discovery, and specific disease susceptibility mutation screening—have enjoyed a significant active contribution to society (see Display 4-1 for definitions).
DNA underlies almost every aspect of human health. Obtaining a detailed picture of how genes and other DNA sequences function together and interact with environmental factors ultimately will lead to the discovery of pathways involved in normal processes and in disease pathogenesis. Such knowledge will have a profound impact on the way disorders are diagnosed, treated, and prevented and will bring about revolutionary changes in clinical and public health practice. Some of these transformative developments are described herein.
How do scientists study and find these genetic mutations? They have available to them a growing battery of tools and technologies to compare a DNA sequence isolated from a healthy person to the same region of DNA extracted from an afflicted person. Advanced computer technologies, combined with the explosion of genetic data that is currently generated from the various whole-genome sequencing projects, enable scientists to use these molecular genetic tools to more accurately diagnose disease and to design new therapeutic interventions. This chapter reviews some common principles that geneticists—scientists who study the inheritance pattern of specific traits—can use to inform clinical practice.
DNAMolecular genetics is the study of the units, or segments, of DNA that pass information from generation to generation. These molecules, our genes, are long sequences of deoxyribonucleic acid, or DNA. Just four chemical building blocks or bases, deoxyguanine (G), deoxyadenine (A), deoxythymine (T), and deoxycytosine (C), are placed in a unique order to encode for all of the heritable units in all living organisms (Fig. 4-1).
DNA is the chemical responsible for preserving, copying, and transmitting information within cells. DNA, located in the nucleus of every cell, harbors the instructions that provide almost all of the information necessary for a living organism to grow and function. The DNA molecule resembles a twisted ladder, usually described as a double helix. The rungs are repeating units called nucleotides, which are the quantum building blocks of DNA. Nucleotides are composed of one sugar-phosphate molecule (the linear strands or outer rails of the DNA ladder) and one base (Fig. 4-2). DNA in eukaryotic cells consists of two nucleotide strands joined by weak chemical bonds between the two bases, forming base pairs. Therefore, a base pair constitutes a “rung” on the ladder of the DNA. The four bases organize in two fundamental pairs, A with T and C with G. One rail of a DNA ladder is a single strand of DNA that is denoted by a sequence of nucleotides (e.g., ACGTGCTGACCTGACGTAGGGCATA), which has complementary bases on the opposite rail, forming complementary nucleotide strands (e.g., TATGCCCTACGTCAGGTCAGCACGT). Within the regions of DNA that express information, these strings of nucleotides are organized into three unit “words” termed codons. These codons are organized into groups called exons. Ultimately, these exons form sentences, or genes. Genes encode all of the necessary information to produce a messenger molecule composed of ribonucleic acids (RNA), which are composed of four other nucleotides: guanine (G), adenine (A), cytosine (C), and uracil (U). Thus, DNA sentences are transcribed into RNA messages, which are single-stranded complementary copies of DNA. Once processed, these messages leave the nucleus and enter another cellular compartment where they are threaded into cellular machinery, which translates the information into its final state, the protein. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs. This process, where DNA is transcribed into RNA and subsequently translated into proteins, represents the central dogma of molecular biology. It is worth noting that a small subset of genes expresses RNA without being translated into proteins. These other forms of RNA play crucial roles in the biology of the cell.
Humans have approximately 3 billion base pairs of DNA in most of their cells. This complete set of genes is called a genome. The exact sequence of the bases is different for everyone, which makes
each of us unique. DNA is an exquisitely small yet extremely long molecule that lacks the tensile strength to remain unprotected during cell division. Accordingly, DNA molecules are packaged into tightly coiled units called chromosomes, found in the nucleus of every cell. Chromosomes consist of the double helix of DNA wrapped around proteins called histones. DNA in the human genome is arranged into 24 distinct chromosomes (i.e., 22 autosomes and two sex chromosomes), physically separate molecules that range in length from about 50 million to 250 million base pairs. The two sex chromosomes determine gender; two copies of the “X” chromosome result in female gender, while one copy each of the “X” and “Y” chromosomes determines male gender (Fig. 4-3). There are 23 pairs of chromosomes in the normal diploid genome in humans (i.e., 22
autosome pairs and either two X chromosomes [i.e., female] or an X and a Y chromosomal pair [i.e., male]). A few types of major chromosomal abnormalities, including missing or extra chromosome copies or gross chromosomal breaks that rejoin at another chromosome location (translocations), can be detected by microscopic examination. Most changes in DNA, however, are far subtler and require a much closer analysis of the DNA molecule.
each of us unique. DNA is an exquisitely small yet extremely long molecule that lacks the tensile strength to remain unprotected during cell division. Accordingly, DNA molecules are packaged into tightly coiled units called chromosomes, found in the nucleus of every cell. Chromosomes consist of the double helix of DNA wrapped around proteins called histones. DNA in the human genome is arranged into 24 distinct chromosomes (i.e., 22 autosomes and two sex chromosomes), physically separate molecules that range in length from about 50 million to 250 million base pairs. The two sex chromosomes determine gender; two copies of the “X” chromosome result in female gender, while one copy each of the “X” and “Y” chromosomes determines male gender (Fig. 4-3). There are 23 pairs of chromosomes in the normal diploid genome in humans (i.e., 22
autosome pairs and either two X chromosomes [i.e., female] or an X and a Y chromosomal pair [i.e., male]). A few types of major chromosomal abnormalities, including missing or extra chromosome copies or gross chromosomal breaks that rejoin at another chromosome location (translocations), can be detected by microscopic examination. Most changes in DNA, however, are far subtler and require a much closer analysis of the DNA molecule.
DISPLAY 4-1 DefinitionsAmino acids.
The building block for proteins. Humans require 20 amino acids as building blocks.
Chromosome.
An arrangement of tightly packed and coiled DNA and protein. Diploid cells such as the human body cells have 23 sets of chromosomes; haploid cells such as gametes—sperm or ova—have only a single set of chromosomes.
DNA.
Deoxyribonucleic acid, the double helix, which codes for the proteins and other elements necessary to construct an organism.
Exon.
Regions of DNA that are expressed, coding for RNA and/or protein.
Gamete.
A sex cell, such as egg or sperm, capable of joining with an opposite gamete (egg plus sperm) to make a zygote.
Gene.
A gene is a segment of DNA or RNA that performs a specific function; usually, it is a segment of DNA that codes for some molecular product, often a protein. Aside from the nucleotides that code for the protein, a gene also consists of segments that determine the type, quantity, and timing of protein expression. Genes can produce different combinations of proteins under different stimuli.
Genome.
The sum total of genetic material in an individual organism.
Genotype.
A relative term that can refer to a particular nucleotide position, or even an entire segment of DNA. A genotype has two components, one from the same position on each chromosome.
Intron.
In most eukaryotic cells, introns are segments of DNA that are a component of gene structure but do not generally code for proteins. Introns are processed out of transcribed messenger RNA (mRNA), or spliced out, before it is threaded into ribosomes for translation into protein.
Mutation.
An alteration in a gene or segment of DNA; mutations are largely accidental and unproductive. On rare occasions, mutations can be dangerous and/or even beneficial. Thus, mutations can lead to variation in the phenotype of an organism.
Phenotype.
The physical structure and/or composition of an organism, or group of organisms. Genotypes expressed in and operating in the context of a given environment(s) determine phenotype.
Protein.
Genes often encode for proteins, which help form and regulate all organisms. Proteins are molecular machines composed of strings of 20 different types of amino acids. Proteins can in turn form complexes, which interact to perform more complex actions and functions.
Ribosomes.
Ribosomes are complexes of RNA and protein, which use the information encoded in mRNA to assemble specific proteins out of amino acids via a process termed translation.
RNA.
Ribonucleic acid; an intermediate, complementary copy of DNA. mRNA is used by ribosomes as templates for the construction of proteins.
Sex chromosomes.
In humans, the X and Y chromosomes. Two X chromosomes result in a female gender, while an X chromosome and a Y chromosome result in a male gender. Other species have different types of sex chromosomes.
Synteny.
Segments of chromosomes, which contain the same sequence of genes, which are shared between different organisms.
 ▪ Figure 4-1 The four DNA bases. Each DNA is made up of the sugar 2′-deoxyribose linked to a phosphate group and one of the four bases depicted above. |
 ▪ Figure 4-2 The DNA molecule consists of two antiparallel, complementary strands of nucleotides that pair A + T or G + C. |
 ▪ Figure 4-3 An example of the human genome condensed into the 22 chromosome pairs (autosomes) and the two sex chromosomes. |
Genes
Each chromosome contains many genes, the basic physical and functional units of heredity in living cells. Genes constitute approximately 2% of the human genome; the remainder consists of noncoding regions, whose functions may include providing chromosomal structural integrity and regulating where, when, and in what quantity proteins are made. Genes consist of a length of DNA that encodes instructions for making a specific RNA or protein. Through these molecular products, our genes influence almost everything about us, including how we grow, process nutrients, reproduce, respond to environmental influences including infections and medicines, and perhaps most important our susceptibility and response to disease.
On cell division, DNA becomes tightly packed into a complex structure called chromatin, which is arranged into chromosomes in each cell nucleus. With a few exceptions, such as red blood cells, platelets, and specialized immune cells and platelets, the DNA in each cell of the human body is complete and identical. The human genome—the complete collection of genetic instructions—is estimated to be composed of approximately 20,000 to 25,000 genes. Genes are defined as the segments of DNA that contain the code for all proteins. Proteins are molecular machines that can perform a vast array of diverse and complex functions. DNA is the template that guides the synthesis of those machines through the direction of DNA’s intermediate, messenger ribonucleic acid (mRNA). The mRNA leaves the nucleus to be processed in the cytoplasm. Ribosomes (a complex of protein and RNA) then use the mRNA to translate the original DNA instructions and synthesize proteins. Some genes perform other functions, such as making the RNA constituents of ribosomes.
When DNA is transcribed to RNA, many lengths of nucleotides do not encode for proteins. These segments of RNA are called introns and are processed out of the RNA segments. The segments that remain (termed exons) are spliced together, forming the mature mRNA; these abridged versions of our genes encode for proteins. In some cases, a length of newly transcribed RNA can be processed in different ways; the sequence of exons used can be spliced together in different combinations to make a variety of different proteins. Thus, a single gene can produce or express a diverse series of protein products, depending on the cell type, timing, and ambient activating conditions. This explains in part how identical embryonic cells differentiate to become a variety of different tissues. Similarly, cardiac cells synthesize proteins required for that organ’s structure and function, whereas liver cells make proteins important in the metabolic functions of that organ.
DNA AND HUMAN DIVERSITYAlthough we all look quite different from one another, we are surprisingly alike at the genetic level. The DNA of most people is 99.9% identical. Only approximately 3 million base pairs are responsible for the differences among us, which is only one tenth of 1% of our genome. Yet these DNA base sequence variations influence most of our physical differences and many other characteristics, also. Gene sequence variations occur in our genes, and a subset of the variations results in different forms of the same gene and are called alleles. People can have two identical or two different alleles for a particular gene.
Genes determine hereditary traits such as eye color or hair color. They do this by providing precise instructions for how every activity in every cell of our body should be performed. For example, a gene may guide a liver cell to remove excess cholesterol from our bloodstream. How does a gene do this? It will instruct the cell to make a particular protein and this protein then performs the actual task. In the case of excess blood cholesterol, it is the receptor proteins on the outside of a liver cell that bind to and remove cholesterol from the blood. The cholesterol molecules can then be transported into the cell, where they are further processed by other proteins.
GENETIC VARIATIONA mutation, more neutrally referred to as a genetic variation, is a change in the DNA sequence of a gene (e.g., an “A” is altered into a C, G, or T) or even a gross alteration in the chromosomes. Polymorphisms (i.e., poly meaning many and morph meaning forms) are arbitrarily defined as common differences in the sequence of DNA, occurring in at least 1% of the population. Mutations are less common differences, which occur in less than 1% of the population. Most DNA variation is functionally neutral (neither beneficial nor harmful), but harmful sequence changes do occur. Changes within genes can result in proteins that do not work normally or do not work at all, which can contribute to disease or affect how an individual responds to a medicine. Mutations may be passed down from parent to child (i.e., in the sperm or egg cells), may occur around the time of conception, or may be acquired during a person’s lifetime. Mutations can arise spontaneously during normal cell functions, such as when a cell divides, or in response to environmental factors such as toxins, radiation, hormones, and even diet.
Many diseases are caused by mutations or changes in the DNA sequence of a gene. When the information encoded in a gene changes, the resulting protein may not function properly or may not even be made at all. In either case, the cells containing that
genetic change may no longer perform as expected. For example, it is now known that mutations in the gene that codes for the cholesterol receptor protein (i.e., the low-density lipoprotein receptor, LDLR) are associated with a disease called familial hypercholesterolemia. The cells of most individuals with this disease exhibit reduced receptor function and, as a result, cannot remove a sufficient amount of low-density lipoprotein (LDL), which carries cholesterol throughout their bloodstream. Such an affected person may then have dangerously high levels of cholesterol, a known risk factor for development of atherosclerosis, putting him or her at increased risk for cardiovascular disease culminating in heart attack and/or stroke.
genetic change may no longer perform as expected. For example, it is now known that mutations in the gene that codes for the cholesterol receptor protein (i.e., the low-density lipoprotein receptor, LDLR) are associated with a disease called familial hypercholesterolemia. The cells of most individuals with this disease exhibit reduced receptor function and, as a result, cannot remove a sufficient amount of low-density lipoprotein (LDL), which carries cholesterol throughout their bloodstream. Such an affected person may then have dangerously high levels of cholesterol, a known risk factor for development of atherosclerosis, putting him or her at increased risk for cardiovascular disease culminating in heart attack and/or stroke.
Genetic variations are differences in DNA sequence among individuals that may underlie differences in health. Genetic variations occurring in more than 1% of a population would be considered useful polymorphisms for population genetic analyses. Polymorphism types include single nucleotide polymorphisms (SNPs), small-scale insertions/deletions, and repetitive elements (satellite DNA). Satellite DNA is common throughout the genome. These groups of variations are segments of DNA that are repeated in tandem and can be used to differentiate individuals with differing numbers of repeats. The most common variations found in genes are SNPs, which can change the protein product, alter the temporal or spatial expression of a gene, or silence its expression altogether. A comprehensive and complex system of repair genes encodes for enzymes that correct nearly all DNA errors. As our bodies change in response to age, illness, and other factors, our DNA repair systems may become less efficient and uncorrected mutations can accumulate, resulting in diseases such as cancer.
GENE TESTINGDNA-based tests are among the first commercial medical applications of the new genetic discoveries. Gene tests can be used to diagnose disease, confirm, and more precisely define a clinical diagnosis, provide prognostic information about the course of a disease, or confirm the existence of a disease in asymptomatic individuals.
Currently, several hundred genetic tests are in clinical use, with a large expansion in available tests expected as a result of the Human Genome Project (HGP). Most current tests detect mutations associated with rare genetic disorders that follow mendelian inheritance patterns. These include cystic fibrosis, sickle cell anemia, and Huntington disease. Recently, tests have been developed to detect mutations for a few more complex conditions such as breast, ovarian, and colon cancers. Although they have limitations, these tests sometimes are used to make risk estimates in asymptomatic individuals with a family history of the disorder. One potential benefit to using such gene tests is that they may provide information to help health care providers and patients and caregivers manage the disease more effectively.
THE HUMAN GENOME PROJECTHGP traces its roots to an initiative in the United States Department of Energy (DOE), which since 1947 has supported the development of new energy resources and technologies and acquiring a deeper understanding of potential health and environmental risks posed by their production and use. In 1986, the DOE announced the Human Genome Initiative, the result of which would provide a reference human genome sequence. Soon thereafter, the DOE joined with the National Institutes of Health (NIH) to develop a plan for a joint HGP that officially began in 1990. During the early years of the HGP, the Wellcome Trust in the United Kingdom joined the effort as a major partner. Important contributions also came from other collaborators around the world, including researchers in Japan, France, Germany, and China. The ultimate goal of the HGP was to generate a high-quality reference DNA sequence for the human genome and to identify all human genes. Other important goals included sequencing the genomes of model organisms to complement our exploration of human DNA, enhancing computational resources to support future research and commercial applications, exploring gene function through mouse-human comparisons, studying human variation, and training future scientists in genomics.
In June 2000, scientists announced the completion of the first working draft of the entire human genome.2,3 The high-quality reference sequence was completed 2 years ahead of schedule in April 2003, marking the achievement of the initial goal of the HGP. Available to researchers worldwide, the human genome reference sequence provides an unprecedented biological resource that will accelerate research and discovery, which are expected to seed a myriad of practical applications. The draft sequence has already aided locating genes associated with human disease. Hundreds of other genome sequence projects on microbes, plants, and animals have been completed since the initiation of the HGP, which have enabled detailed comparisons among organisms.
PHARMACOGENOMICSIt is estimated that more than 100,000 people die each year from adverse responses to medications. Another 2.2 million individuals experience serious reactions, while others fail to respond at all. Researchers are beginning to correlate DNA variants with individual responses to medical treatments, permitting identification of particular subgroups of patients, and develop drugs customized for those populations. The discipline that blends pharmacology with genomics is called pharmacogenomics.
DNA variants in genes involved in drug metabolism are the focus of much current research in this area. Enzymes encoded by these genes are responsible for metabolizing most drugs used today, including many for treating cardiovascular diseases. Enzyme function affects patient responses to both the drug and its dose response. Future advances will enable rapid testing to determine the patient’s genotype and guide treatment with the most effective drugs, in addition to drastically reducing adverse reactions.
Genomic data and technologies also are expected to make drug development faster, cheaper, and more effective. New drugs aimed at specific sites in the body and at particular biochemical events leading to disease will cause fewer side effects than many current medicines. Ideally, the new genomic drugs could be administered earlier in the disease process. As knowledge becomes available to select patients most likely to benefit from a potential drug, pharmacogenomics will hasten the design of clinical trials to bring drugs into clinical use sooner.
BIOCHEMICAL BASIS OF GENETIC DISEASEOur genetic constitution, the way in which our individual genome interacts with the environment, can impact our health in many
ways. An individual can inherit genetic diseases, caused by abnormal groups of genes passed down from one generation to the next. Such heritable disorders are classified into three general classes. The first class is single gene mutations of large effect, which can be readily identified given detailed family history review coupled with appropriate genetic testing (e.g., familial hypercholesterolemia). This class of genetic disorders is commonly referred to as mendelian disorders, named after the founder of the modern principles of genetics, Gregor Mendel.4 The more common class of heritable disorders is those of multifactorial inheritance, caused by the complex interplay of several genes and environmental factors (e.g., diabetes, hypertension, and atherosclerosis). The last class is chromosomal aberrations, abnormalities of either chromosomal structure or number. Such gross alterations to the genome can result from a cellular “accident” or from a parent who carries a chromosomal aberration (e.g., trisomy 21 or Down syndrome).
ways. An individual can inherit genetic diseases, caused by abnormal groups of genes passed down from one generation to the next. Such heritable disorders are classified into three general classes. The first class is single gene mutations of large effect, which can be readily identified given detailed family history review coupled with appropriate genetic testing (e.g., familial hypercholesterolemia). This class of genetic disorders is commonly referred to as mendelian disorders, named after the founder of the modern principles of genetics, Gregor Mendel.4 The more common class of heritable disorders is those of multifactorial inheritance, caused by the complex interplay of several genes and environmental factors (e.g., diabetes, hypertension, and atherosclerosis). The last class is chromosomal aberrations, abnormalities of either chromosomal structure or number. Such gross alterations to the genome can result from a cellular “accident” or from a parent who carries a chromosomal aberration (e.g., trisomy 21 or Down syndrome).
Altered gene function can manifest at the molecular level in several ways. Genetic alterations can result in enzyme defects, which result in the synthesis of a defective enzyme with reduced activity or reduce quantity. This can lead to substrate accumulation, a metabolic block with a decreased amount of end product, or the failure to inactivate a tissue-damaging substrate. Another mechanism of disease is malfunctions in receptors and transport systems. For example, in familial hypercholesterolemia, a reduced function of LDL receptor leads to an inability to transport LDL into the cell, which causes elevated levels of plasma cholesterol and accelerates atherosclerosis.5
As the science of genetics has matured, research has shifted focus from rare, single gene disorders to common, multifactorial chronic diseases. Chronic disease affects more than 90 million Americans, accounting for 70% of all deaths and 60% of the nation’s medical costs. As research progresses, genetics offers the opportunity to target health promotion and disease prevention programs better and the possibility to conserve health care program resources. However, the contribution of genetics to chronic disease is complex, reflecting the interaction of many genes with the environment and with one another.6
OVERVIEW: HEART DISEASECardiovascular Disease
According to the Centers for Disease Control and Prevention, cardiovascular disease, principally heart disease and stroke, is the leading cause of death among men and women in all racial and ethnic groups. Cardiovascular disease affects approximately 58 million Americans and costs the nation $274 billion each year, including health expenditures and lost productivity. Research has begun to uncover a number of potential genetic susceptibility genes for heart disease and stroke and their risk factors (e.g., obesity and high blood pressure).7
Heart disease has become a major focus of genetic research. In the past decade, the number of publications on genetic contributions to heart disease has risen exponentially. Genetic mutations have been associated with various risk factors for heart disease, including lipid metabolism and transport, hypertension, and elevated plasma homocysteine levels. It is believed that while traditional risk factors including environmental influences explain approximately 50% of the cases of cardiovascular disease, genetics may help explain the remaining disease burden.
Stroke
Studies also have indicated a genetic predisposition to ischemic and hemorrhagic stroke. Although single gene disorders explain a small fraction of strokes, the genetic contribution to stroke most likely will be multifactorial and complex. Recent family studies, including the Framingham Heart Study, have highlighted a significant genetic component to stroke.8 Twin and family studies provide evidence that genetic factors contribute to the risk of stroke and that their role may be at least as important in stroke as in coronary heart disease. Genetic variation of cystathionine β-synthase or methylenetetrahydrofolate reductase9 result in markedly elevated plasma homocysteine levels and homocystinuria.10 Homocysteine is a sulfur-containing amino acid derivative formed during methionine metabolism. Homocystinemia increases the risk of coronary artery disease (CAD), peripheral artery disease, stroke, and venous thrombosis, and it is a risk factor for premature vascular disease.11 The angiotensin-1-converting enzyme gene harbors a polymorphism, which in some but not all studies is a risk factor for myocardial infarction. Similar studies in stroke patients also show inconsistent results, but most of these studies have been underpowered to detect a small contribution to stroke risk from the ACE gene. Recent meta-analysis suggests that the polymorphism, acting recessively, is a modest but independent risk factor for ischemic stroke onset.12
The apolipoprotein E (apoE) ε4 allele is associated with increased risk of coronary heart disease and is also a major genetic susceptibility locus for Alzheimer disease. This polymorphism is also associated with ischemic stroke and poorer outcomes after stroke. Carriers of the rare ε4 are more frequent among patients with ischemic cerebrovascular disease compared with control subjects. A recent meta-analysis provides evidence for a role for the apoE genotype in the pathogenesis of some cases of ischemic cerebrovascular disease.13
Atherosclerosis
Atherosclerosis is a progressive disease characterized by the accumulation of lipids and fibrous elements in the large arteries (see Chapter 5). The early lesions of atherosclerosis consist of subendothelial accumulations of cholesterol-engorged macrophages called foam cells. Lesions are usually found in the aorta in the first decade of life, the coronary arteries in the second decade, and the cerebral arteries in the third or fourth decade. Because of differences in blood flow dynamics, there are preferred sites of lesion formation within the arteries. Plaques can become increasingly complex, involving calcification, ulceration, and hemorrhage from small vessels within the lesion. Although advanced lesions may encroach and block blood flow, the critical clinical complication is an acute occlusion caused by thrombus formation, resulting in angina, myocardial infarction, or stroke.
Sudden Cardiac Death
Although CAD accounts for the majority of sudden death cases in cardiac arrest, a small proportion (<5%) is attributable to sudden arrhythmia death syndrome. A prolonged Q-T interval is a common thread among the various phenotypes associated with this phenomenon. A number of drugs are known to cause QT prolongation, as well as disorders of potassium, calcium, and magnesium homeostasis, myocarditis, and endocrine and nutritional disorders.
Recently, attention has focused on a group of inherited gene mutations in cardiac ion channels that cause long QT syndrome with an increased risk for sudden death. The age of onset for long QT-related death is the early 30s, with men disproportionately affected. Most cardiac events are precipitated by intense exercise or emotional stress, but they can also occur during sleep. Unfortunately, not all persons with long QT syndrome have previous symptoms or identifiable electrocardiographic abnormalities and may present with sudden death. Antiarrhythmic agents and implantable defibrillators are used for the treatment of long QT syndrome, although identification of the specific gene variants underlying this syndrome will almost certainly better direct prophylactic therapy.14
Recently, attention has focused on a group of inherited gene mutations in cardiac ion channels that cause long QT syndrome with an increased risk for sudden death. The age of onset for long QT-related death is the early 30s, with men disproportionately affected. Most cardiac events are precipitated by intense exercise or emotional stress, but they can also occur during sleep. Unfortunately, not all persons with long QT syndrome have previous symptoms or identifiable electrocardiographic abnormalities and may present with sudden death. Antiarrhythmic agents and implantable defibrillators are used for the treatment of long QT syndrome, although identification of the specific gene variants underlying this syndrome will almost certainly better direct prophylactic therapy.14
THE GENETICS OF CARDIOVASCULAR DISEASEEpidemiological studies over the past 50 years have identified many risk factors for atherosclerosis (Table 4-1). Dyslipidemia appears to be of primary importance, because raised levels of atherogenic lipoproteins are a prerequisite for most forms of atherosclerosis. With the exception of gender and the level of lipoprotein(a), each of the genetic risk factors involves multiple genes. An added level of complexity involves the interactions between risk factors that are often not simply additive. For example, the effects of hypertension on CAD are considerably amplified if cholesterol levels are high.24
The importance of genetics and environment in human CAD has been examined in family and twin studies.21 The heritability (the portion attributed to genetic factors and shared environment) of atherosclerosis has been high in most population studies, often in excess of 50%. It is also evident that the environment explains much of the variation in disease incidence between populations. Thus, the common forms of CAD result from the combination of unfavorable genetic and environmental factors and our increased lifespan.24
Table 4-1 ▪ GENETIC AND ENVIRONMENTAL FACTORS ASSOCIATED WITH ATHEROSCLEROSIS AND CORONARY HEART DISEASE | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Generally, the manifestation of CAD is caused by the interaction of several genetic and environmental factors, with those patients with the greatest number of risk factors, including genetic and environmental, facing the highest risk at earlier ages. Several biochemical processes are involved in atherosclerosis formation, progression, and culmination as acute coronary syndromes. Lipid and apolipoprotein metabolism, inflammatory response, endothelial function, platelet function, thrombosis, fibrinolysis, homocysteine metabolism, insulin sensitivity, and blood pressure regulation have been demonstrated to influence disease pathophysiology.28, 29, 30 Each of these biochemical processes involves the complex interplay of enzymes, receptors, and ligands encoded by our genes, the expressions of which are also influenced by environmental factors. Genetic variations can modulate the function of these constituents, resulting in altered susceptibility to the development and progression of CAD.31 Several well-established environmental risk factors that predispose to CAD have also been identified (Table 4-2).
The treatment and prevention of CAD has improved greatly in the past decades; however, it remains the leading cause of death and premature disability in the United States. The cumulative risk for CAD by age 70 is 30% and 15% in men and women, respectively, and increases to 48% and 30% by the age of 90 years.44 Moreover, it is now clear that disability and mortality from CAD at young ages is particularly devastating to families and has a substantial impact on our economy. Understanding the genetic basis of CAD is expected to improve disease management by providing improved diagnosis, targeted therapies, and prognosis.
Genetic Aspects/Dissection of Atherosclerosis
Although the common forms of atherosclerosis are multifactorial, studies of rare, mendelian forms have contributed vital insights
into disease pathogenesis (see Table 4-2). Studies of familial hypercholesterolemia helped unravel the pathways that regulate plasma cholesterol metabolism, knowledge of which was important for the development of cholesterol-lowering interventions. In contrast to the mendelian disorders, dissecting the genetic contribution of common, complex forms of CAD has proven more difficult. Studies of candidate genes have suggested a number of genes influencing the traits relevant to atherosclerosis, but our understanding remains incomplete (see Table 4-2). Large-scale sequencing is now underway to identify polymorphisms for many other candidate genes for hypertension, diabetes, and other traits relevant to atherosclerosis.45 In an attempt to identify further atherosclerosis genes, whole-genome scans (a method of fingerprinting the entire genome in attempts to identify genes shared in affected individuals more often than with their relatives) for loci associated with diabetes, hyperlipidemia, low high-density lipoprotein (HDL) levels, and hypertension have been performed,46 but few loci with significant evidence of linkage have been found, emphasizing the complexity of these traits.
into disease pathogenesis (see Table 4-2). Studies of familial hypercholesterolemia helped unravel the pathways that regulate plasma cholesterol metabolism, knowledge of which was important for the development of cholesterol-lowering interventions. In contrast to the mendelian disorders, dissecting the genetic contribution of common, complex forms of CAD has proven more difficult. Studies of candidate genes have suggested a number of genes influencing the traits relevant to atherosclerosis, but our understanding remains incomplete (see Table 4-2). Large-scale sequencing is now underway to identify polymorphisms for many other candidate genes for hypertension, diabetes, and other traits relevant to atherosclerosis.45 In an attempt to identify further atherosclerosis genes, whole-genome scans (a method of fingerprinting the entire genome in attempts to identify genes shared in affected individuals more often than with their relatives) for loci associated with diabetes, hyperlipidemia, low high-density lipoprotein (HDL) levels, and hypertension have been performed,46 but few loci with significant evidence of linkage have been found, emphasizing the complexity of these traits.
Table 4-2 ▪ GENETIC CHANGES RELEVANT TO HEART DISEASE* | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stay updated, free articles. Join our Telegram channel
Full access? Get Clinical Tree
